The recent outbreak of Zika virus (ZIKV) in areas endemic flavivirus-highlight the need for sensitive and specific serological tests. Previously, we and others reported the fusion loop lock (FL) residue and / or the BC loop (BCL) residues on the envelope protein of dengue virus (DENV) is recognized by flavivirus cross-reactive human monoclonal antibodies and polyclonal sera.

To improve ZIKV serodiagnosis, we employ wild type (WT) and FL or FL / BCL mutant virus-like particle (VLP) from ZIKV, DENV1 and the West Nile virus (WNV) in enzyme linked immunosorbent assay (ELISA), and tested convalescent- phase serum or plasma samples from reverse-transcription PCR-confirmed cases with different ZIKV, DENV and WNV infection. For the IgG ELISA, ZIKV WT-VLP had a sensitivity of 100% and a specificity of 52.9%, which increased to 83.3% by FL / BCL mutant VLP and 92.2% with relative optical density ratio WT mutant VLP.

Similarly, DENV1 and WNV-VLP WT has a sensitivity / specificity of 100% / 70.0% and 100% / 56.3%, respectively; specificity increased to 93.3% and 83.0% by FL mutant VLP. For IgM ELISA, ZIKV, DENV1 and WNV-VLP WT has a specificity of 96.4%, 92.3% and 91.4%, respectively, for the primary infection; improved specificity of 93.7 to 99.3% by FL or FL / BCL mutant VLP. An algorithm based on a combination of mutant and WT-VLP IgG ELISA is proposed for the main ZIKV discrimination, DENV and WNV infection and secondary DENV infections and ZIKV with previous DENV infection; This can be a powerful tool to better understand the pathogenesis of seroprevalence and ZIKV in an area where several flaviviruses co-circulate.

elisa kite, elisa kit, elisa kits are, elisa kit pdf, elisa kit ppb, elisa kit usa, elisa kit bdnf, elisa kit wiki, elisa kits china, elisa kit egypt, elisa kit india, elisa kit mumps,
elisa kite, elisa kit, elisa kits are, elisa kit pdf, elisa kit ppb, elisa kit usa, elisa kit bdnf, elisa kit wiki, elisa kits china, elisa kit egypt, elisa kit india, elisa kit mumps,

serotype-specific detection of dengue virus nonstructural protein 1-based enzyme-linked immunosorbent assay validated by multi-national cohort

Background: Dengue virus (DENV) infection poses one the biggest obstacle to global human health. Four serotypes (DENV 1-4) present different symptoms and influence the immune responds next DENV infection, rendering surveillance, risk assessment, and control of diseases especially challenging. Early diagnosis and clinical management is very important and can be achieved by detection of DENV nonstructural protein 1 (NS1) in serum during the acute phase. However, some of the NS1-based test has been developed which is able to distinguish serotype DENV and none are currently available commercially.

Methodology / findings principles: We develop enzyme-linked immunosorbent assay (ELISA) to distinguish DENV-1-4 NS1 using serotype-specific pair of monoclonal antibodies. A total of 1,046 antibodies harvested from DENV-immunized mice and screened for antigen binding affinity. Clinical performance was evaluated using the ELISA-reaction confirmed 408 dengue polymerase chain samples obtained from patients in Brazil, Honduras, and India. The overall sensitivity of the test for the pan-DENV was 79.66% (325/408), and sensitivity to serotype DENV-1-4 were 79.1% (38/48), 80.41% (78/97), 100% ( 45/45) and 79.6% (98/123), respectively. Specificity reaches 94.07 to 100%.

Significance: Our research shows that strong antibody screening strategy that enables the development of ELISA-based NS1 serotype with a maximized specific and sensitive antigen binding. sensitive and specific assay was also used cohort most expansive to date, and where about half of Latin America, the geographic area is very under-represented in previous similar studies. ELISA test offers the potential for enhanced diagnosis during the acute phase of infection to help guide patient care and disease control.

Rat Diamine Oxidase (DAO) ELISA Kit

DLR-DAO-Ra-48T 48T
EUR 508
  • Should the Rat Diamine Oxidase (DAO) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Diamine Oxidase (DAO) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.

Rat Diamine Oxidase (DAO) ELISA Kit

DLR-DAO-Ra-96T 96T
EUR 661
  • Should the Rat Diamine Oxidase (DAO) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Diamine Oxidase (DAO) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.

Human Diamine Oxidase (DAO) ELISA Kit

RDR-DAO-Hu-48Tests 48 Tests
EUR 500

Human Diamine Oxidase (DAO) ELISA Kit

RDR-DAO-Hu-96Tests 96 Tests
EUR 692

Porcine Diamine Oxidase (DAO) ELISA Kit

RDR-DAO-p-48Tests 48 Tests
EUR 580

Porcine Diamine Oxidase (DAO) ELISA Kit

RDR-DAO-p-96Tests 96 Tests
EUR 807

Rat Diamine Oxidase (DAO) ELISA Kit

RDR-DAO-Ra-48Tests 48 Tests
EUR 534

Rat Diamine Oxidase (DAO) ELISA Kit

RDR-DAO-Ra-96Tests 96 Tests
EUR 742

Human Diamine Oxidase (DAO) ELISA Kit

RD-DAO-Hu-48Tests 48 Tests
EUR 478

Human Diamine Oxidase (DAO) ELISA Kit

RD-DAO-Hu-96Tests 96 Tests
EUR 662

Porcine Diamine Oxidase (DAO) ELISA Kit

RD-DAO-p-48Tests 48 Tests
EUR 555

Porcine Diamine Oxidase (DAO) ELISA Kit

RD-DAO-p-96Tests 96 Tests
EUR 771

Rat Diamine Oxidase (DAO) ELISA Kit

RD-DAO-Ra-48Tests 48 Tests
EUR 511

Rat Diamine Oxidase (DAO) ELISA Kit

RD-DAO-Ra-96Tests 96 Tests
EUR 709

Dao/ Rat Dao ELISA Kit

ELI-46592r 96 Tests
EUR 886


EMD0039 96Tests
EUR 521

DAO ELISA Kit (Mouse) (OKEH05527)

OKEH05527 96 Wells
EUR 779
Description: Description of target: Regulates the level of the neuromodulator D-serine in the brain. Has high activity towards D-DOPA and contributes to dopamine synthesis. Could act as a detoxifying agent which removes D-amino acids accumulated during aging. Acts on a variety of D-amino acids with a preference for those having small hydrophobic side chains followed by those bearing polar, aromatic, and basic groups. Does not act on acidic amino acids. ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Competitive ELISA;Sensitivity: 39 pg/mL

Mouse diamine oxidase(DAO)ELISA Kit    

GA-E0588MS-48T 48T
EUR 336

Mouse diamine oxidase(DAO)ELISA Kit    

GA-E0588MS-96T 96T
EUR 534

Mouse DAO(Diamine Oxidase) ELISA Kit

EM0980 96T
EUR 524.1
  • Detection range: 3.906-250 ng/ml
  • Uniprot ID: P18894
  • Alias: DAO/AOC1/DAO/Diamine Oxidase/Histaminase/KAO/ABP/amiloride binding protein 1(amine oxidase(copper-containing))/Amiloride-binding protein/amiloride-sensitive amine oxidase/amiloride-sensitive
  • Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 2.344 ng/ml

Mouse diamine oxidase, DAO ELISA Kit

CSB-E10090m-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse diamine oxidase, DAO in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Mouse diamine oxidase, DAO ELISA Kit

  • EUR 946.00
  • EUR 5782.00
  • EUR 3060.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse diamine oxidase, DAO in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Mouse diamine oxidase,DAO ELISA Kit

CN-02511M1 96T
EUR 436

Mouse diamine oxidase,DAO ELISA Kit

CN-02511M2 48T
EUR 287

Mouse Diamine Oxidase (DAO) ELISA Kit

SEA656Mu-10x96wellstestplate 10x96-wells test plate
EUR 4391.16
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Diamine Oxidase (DAO) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Diamine Oxidase (DAO) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Diamine Oxidase (DAO) ELISA Kit

SEA656Mu-1x48wellstestplate 1x48-wells test plate
EUR 449.27
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Diamine Oxidase (DAO) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Diamine Oxidase (DAO) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Diamine Oxidase (DAO) ELISA Kit

SEA656Mu-1x96wellstestplate 1x96-wells test plate
EUR 598.96
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Diamine Oxidase (DAO) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Diamine Oxidase (DAO) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Diamine Oxidase (DAO) ELISA Kit

SEA656Mu-5x96wellstestplate 5x96-wells test plate
EUR 2395.32
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Diamine Oxidase (DAO) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Diamine Oxidase (DAO) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Diamine Oxidase (DAO) ELISA Kit

  • EUR 4442.00
  • EUR 2346.00
  • EUR 599.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Diamine Oxidase elisa. Alternative names of the recognized antigen: AOC1
  • ABP1
  • KAO
  • Histaminase
  • Kidney amine oxidase
  • Amiloride Binding Protein 1
  • Amiloride-sensitive amine oxidase
  • Amine oxidase copper domain-containing protein 1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Diamine Oxidase (DAO) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Mouse Diamine Oxidase ELISA Kit (DAO)

RK02737 96 Tests
EUR 521

Mouse diamine oxidase(DAO)ELISA Kit

QY-E20470 96T
EUR 361


EHD0039 96Tests
EUR 521


ELA-E13922h 96 Tests
EUR 824


EGTD0039 96Tests
EUR 521

Canine DAO ELISA Kit

ECD0039 96Tests
EUR 521

Chicken DAO ELISA Kit

ECKD0039 96Tests
EUR 521

Bovine DAO ELISA Kit

EBD0039 96Tests
EUR 521

Anserini DAO ELISA Kit

EAD0039 96Tests
EUR 521


EF005669 96 Tests
EUR 689

Porcine DAO ELISA Kit

EPD0039 96Tests
EUR 521


ERD0039 96Tests
EUR 521

Rabbit DAO ELISA Kit

ERTD0039 96Tests
EUR 521


ESD0039 96Tests
EUR 521

Monkey DAO ELISA Kit

EMKD0039 96Tests
EUR 521

DAO ELISA Kit| Mouse Diamine Oxidase ELISA Kit

EF013561 96 Tests
EUR 689

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

EUR 202

ELISA kit for Mouse DAO (Diamine Oxidase)

E-EL-M0412 1 plate of 96 wells
EUR 534
  • Gentaur's DAO ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Mouse DAO. Standards or samples are added to the micro ELISA plate wells and combined with the
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Mouse DAO (Diamine Oxidase) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Mouse DAO (Diamine Oxidase)

ELK5316 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Diamine Oxidase (DAO). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Diamine Oxid
  • Show more
Description: A sandwich ELISA kit for detection of Diamine Oxidase from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Mouse Diamine oxidase (DAO)

KTE70533-48T 48T
EUR 354
  • On the basis of its primary structure, the amiloride-binding protein (EC is 713 amino acids long, with a 19-amino acid signal peptide. Expressed in cultured cells, the mRNA yields a glycoprotein that binds amiloride and amiloride analogs wit
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Diamine oxidase (DAO) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Diamine oxidase (DAO)

KTE70533-5platesof96wells 5 plates of 96 wells
EUR 2252
  • On the basis of its primary structure, the amiloride-binding protein (EC is 713 amino acids long, with a 19-amino acid signal peptide. Expressed in cultured cells, the mRNA yields a glycoprotein that binds amiloride and amiloride analogs wit
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Diamine oxidase (DAO) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Diamine oxidase (DAO)

KTE70533-96T 96T
EUR 572
  • On the basis of its primary structure, the amiloride-binding protein (EC is 713 amino acids long, with a 19-amino acid signal peptide. Expressed in cultured cells, the mRNA yields a glycoprotein that binds amiloride and amiloride analogs wit
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Diamine oxidase (DAO) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Guinea Pig DAO ELISA Kit

EGD0039 96Tests
EUR 521

DAO ELISA Kit (Human) (OKAN05362)

OKAN05362 96 Wells
EUR 792
Description: Description of target: This gene encodes the peroxisomal enzyme D-amino acid oxidase. The enzyme is a flavoprotein which uses flavin adenine dinucleotide (FAD) as its prosthetic group. Its substrates include a wide variety of D-amino acids, but it is inactive on the naturally occurring L-amino acids. Its biological function is not known; it may act as a detoxifying agent which removes D-amino acids that accumulate during aging. In mice, it degrades D-serine, a co-agonist of the NMDA receptor. This gene may play a role in the pathophysiology of schizophrenia.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.56 ng/mL

DAO ELISA Kit (Rat) (OKAN05493)

OKAN05493 96 Wells
EUR 792
Description: Description of target: ;Species reactivity: Rat;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.236 ng/mL

DAO ELISA Kit (Human) (OKCD09181)

OKCD09181 96 Wells
EUR 975
Description: Description of target: Recombinant Human D-Amino Acid Oxidase ;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.56ng/mL

DAO ELISA Kit (Rabbit) (OKCA00937)

OKCA00937 96 Wells
EUR 956
Description: Description of target: Regulates the level of the neuromodulator D-serine in the brain. Has high activity towards D-DOPA and contributes to dopamine synthesis. Could act as a detoxifying agent which removes D-amino acids accumulated during aging. Acts on a variety of D-amino acids with a preference for those having small hydrophobic side chains followed by those bearing polar, aromatic, and basic groups. Does not act on acidic amino acids.;Species reactivity: Rabbit;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.312 U/mL

DAO ELISA Kit (Rat) (OKCA00969)

OKCA00969 96 Wells
EUR 956
Description: Description of target: Regulates the level of the neuromodulator D-serine in the brain. Has high activity towards D-DOPA and contributes to dopamine synthesis. Could act as a detoxifying agent which removes D-amino acids accumulated during aging. Acts on a variety of D-amino acids with a preference for those having small hydrophobic side chains followed by those bearing polar, aromatic, and basic groups. Does not act on acidic amino acids.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.195 mIU/mL

DAO ELISA Kit (Pig) (OKEH07970)

OKEH07970 96 Wells
EUR 1092
Description: Description of target: ;Species reactivity: Pig;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity:

Mouse Dao/ D-amino-acid oxidase ELISA Kit

E0378Mo 1 Kit
EUR 632

Mouse D- amino- acid oxidase, Dao ELISA KIT

ELI-16169m 96 Tests
EUR 865

Mouse Diamine Oxidase (DAO) CLIA Kit

abx195143-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Mouse Diamine Oxidase (DAO) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Dao ELISA Kit| Mouse D-amino-acid oxidase ELISA Kit

EF014627 96 Tests
EUR 689

Mouse DAO shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

DAO Recombinant Protein (Mouse)

RP127823 100 ug Ask for price

Porcine diamine oxidase, DAO ELISA Kit

ELA-E0656p 96 Tests
EUR 928

Rat diamine oxidase, DAO ELISA Kit

ELA-E0656r 96 Tests
EUR 886

Bovine DAO(Diamine Oxidase) ELISA Kit

EB0118 96T
EUR 567.6
  • Detection range: 15.625-1000 ng/ml
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Cattle;Sensitivity: 9.375 ng/ml

Rat diamine oxidase(DAO)ELISA Kit

GA-E0233RT-48T 48T
EUR 317

Rat diamine oxidase(DAO)ELISA Kit

GA-E0233RT-96T 96T
EUR 496

Human diamine oxidase(DAO)ELISA Kit

GA-E0793HM-48T 48T
EUR 289

Human diamine oxidase(DAO)ELISA Kit

GA-E0793HM-96T 96T
EUR 466

Rat DAO(Diamine Oxidase) ELISA Kit

ER0895 96T
EUR 524.1
  • Detection range: 3.125-200 ng/ml
  • Uniprot ID: O35078
  • Alias: DAO
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rattus;Sensitivity: 1.875 ng/ml

Porcine DAO(Diamine Oxidase) ELISA Kit

EP0047 96T
EUR 567.6
  • Detection range: 1.563-100 ng/ml
  • Alias: Amiloride-binding protein 1/Amine oxidase copper domain-containing protein 1/Histaminase/Kidney amine oxidase/KAO/ABP1/DAO1/AOC1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Pig;Sensitivity: 0.938 ng/ml

Human diamine oxidase,DAO ELISA Kit

201-12-0777 96 tests
EUR 440
  • This diamine oxidase ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human diamine oxidase, DAO ELISA Kit

CSB-E10137h-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human diamine oxidase, DAO in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human diamine oxidase, DAO ELISA Kit

  • EUR 900.00
  • EUR 5476.00
  • EUR 2900.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human diamine oxidase, DAO in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Rat diamine oxidase(DAO) ELISA Kit

CSB-E12634r-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Rat diamine oxidase (DAO) in samples from serum, plasma, cell culture supernates, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Rat diamine oxidase(DAO) ELISA Kit

  • EUR 946.00
  • EUR 5782.00
  • EUR 3060.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Rat diamine oxidase(DAO) in samples from serum, plasma, cell culture supernates, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

PoFAine diamine oxidase,DAO ELISA Kit

CN-01272P1 96T
EUR 447

PoFAine diamine oxidase,DAO ELISA Kit

CN-01272P2 48T
EUR 296

Human diamine oxidase,DAO ELISA Kit

CN-03719H1 96T
EUR 458

Human diamine oxidase,DAO ELISA Kit

CN-03719H2 48T
EUR 307

Human Diamine Oxidase (DAO) ELISA Kit

SEA656Hu-10x96wellstestplate 10x96-wells test plate
EUR 4273.35
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Diamine Oxidase (DAO) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Diamine Oxidase (DAO) in serum, plasma, tissue homogenates and other biological fluids.

Human Diamine Oxidase (DAO) ELISA Kit

SEA656Hu-1x48wellstestplate 1x48-wells test plate
EUR 439.57
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Diamine Oxidase (DAO) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Diamine Oxidase (DAO) in serum, plasma, tissue homogenates and other biological fluids.

Human Diamine Oxidase (DAO) ELISA Kit

SEA656Hu-1x96wellstestplate 1x96-wells test plate
EUR 585.1
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Diamine Oxidase (DAO) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Diamine Oxidase (DAO) in serum, plasma, tissue homogenates and other biological fluids.

Human Diamine Oxidase (DAO) ELISA Kit

SEA656Hu-5x96wellstestplate 5x96-wells test plate
EUR 2332.95
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Diamine Oxidase (DAO) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Diamine Oxidase (DAO) in serum, plasma, tissue homogenates and other biological fluids.

Human Diamine Oxidase (DAO) ELISA Kit

  • EUR 4324.00
  • EUR 2283.00
  • EUR 586.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Diamine Oxidase elisa. Alternative names of the recognized antigen: AOC1
  • ABP1
  • KAO
  • Histaminase
  • Kidney amine oxidase
  • Amiloride Binding Protein 1
  • Amiloride-sensitive amine oxidase
  • Amine oxidase copper domain-containing protein 1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Diamine Oxidase (DAO) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Pig Diamine Oxidase (DAO) ELISA Kit

SEA656Po-10x96wellstestplate 10x96-wells test plate
EUR 5098.02
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Pig Diamine Oxidase (DAO) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Pig Diamine Oxidase (DAO) in serum, plasma, tissue homogenates and other biological fluids.

Pig Diamine Oxidase (DAO) ELISA Kit

SEA656Po-1x48wellstestplate 1x48-wells test plate
EUR 507.48
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Pig Diamine Oxidase (DAO) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Pig Diamine Oxidase (DAO) in serum, plasma, tissue homogenates and other biological fluids.

Pig Diamine Oxidase (DAO) ELISA Kit

SEA656Po-1x96wellstestplate 1x96-wells test plate
EUR 682.12
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Pig Diamine Oxidase (DAO) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Pig Diamine Oxidase (DAO) in serum, plasma, tissue homogenates and other biological fluids.

Pig Diamine Oxidase (DAO) ELISA Kit

SEA656Po-5x96wellstestplate 5x96-wells test plate
EUR 2769.54
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Pig Diamine Oxidase (DAO) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Pig Diamine Oxidase (DAO) in serum, plasma, tissue homogenates and other biological fluids.

Pig Diamine Oxidase (DAO) ELISA Kit

  • EUR 5149.00
  • EUR 2720.00
  • EUR 683.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Diamine Oxidase elisa. Alternative names of the recognized antigen: AOC1
  • ABP1
  • KAO
  • Histaminase
  • Kidney amine oxidase
  • Amiloride Binding Protein 1
  • Amiloride-sensitive amine oxidase
  • Amine oxidase copper domain-containing protein 1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Pig Diamine Oxidase (DAO) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Rat Diamine Oxidase (DAO) ELISA Kit

SEA656Ra-10x96wellstestplate 10x96-wells test plate
EUR 4626.78
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Diamine Oxidase (DAO) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Diamine Oxidase (DAO) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Rat Diamine Oxidase (DAO) ELISA Kit

SEA656Ra-1x48wellstestplate 1x48-wells test plate
EUR 468.68
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Diamine Oxidase (DAO) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Diamine Oxidase (DAO) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Rat Diamine Oxidase (DAO) ELISA Kit

SEA656Ra-1x96wellstestplate 1x96-wells test plate
EUR 626.68
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Diamine Oxidase (DAO) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Diamine Oxidase (DAO) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Rat Diamine Oxidase (DAO) ELISA Kit

SEA656Ra-5x96wellstestplate 5x96-wells test plate
EUR 2520.06
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Diamine Oxidase (DAO) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Diamine Oxidase (DAO) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Rat Diamine Oxidase (DAO) ELISA Kit

  • EUR 4677.00
  • EUR 2471.00
  • EUR 627.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Diamine Oxidase elisa. Alternative names of the recognized antigen: AOC1
  • ABP1
  • KAO
  • Histaminase
  • Kidney amine oxidase
  • Amiloride Binding Protein 1
  • Amiloride-sensitive amine oxidase
  • Amine oxidase copper domain-containing protein 1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Diamine Oxidase (DAO) in samples from serum, plasma, tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Diamine Oxidase ELISA Kit (DAO)

RK01242 96 Tests
EUR 521

Porcine Diamine Oxidase ELISA Kit (DAO)

RK03313 96 Tests
EUR 521

Rat Diamine Oxidase ELISA Kit (DAO)

RK03613 96 Tests
EUR 521

Human diamine oxidase(DAO)ELISA Kit

QY-E03708 96T
EUR 361

Rat diamine oxidase(DAO)ELISA Kit

QY-E11419 96T
EUR 361

Goat diamine oxidase,DAO ELISA KIT

QY-E140016 96T
EUR 413

Porcine diamine oxidase (DAO) ELISA Kit

QY-E40051 96T
EUR 400

Canine diamine oxidase,DAO ELISA Kit

QY-E70001 96T
EUR 426

DAO ELISA Kit| Porcine Diamine Oxidase ELISA Kit

EF016588 96 Tests
EUR 689

DAO ELISA Kit| Rat Diamine Oxidase ELISA Kit

EF017679 96 Tests
EUR 689


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

DAO Antibody

ABD7266 100 ug
EUR 438

DAO Antibody

32763-100ul 100ul
EUR 252

DAO Antibody

DF7266 200ul
EUR 304
Description: DAO Antibody detects endogenous levels of total DAO.

DAO Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DAO. Recognizes DAO from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:500

Mouse D-Amino Acid Oxidase/ DAMOX (DAO) ELISA Kit

abx516676-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

CLIA kit for Mouse DAO (Diamine Oxidase)

E-CL-M0259 1 plate of 96 wells
EUR 584
  • Gentaur's DAO CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Mouse DAO . Standards or samples are added to the micro CLIA plate wells and combined with the sp
  • Show more
Description: A sandwich CLIA kit for quantitative measurement of Mouse DAO (Diamine Oxidase) in samples from Serum, Plasma, Cell supernatant

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Mouse Diamine Oxidase (DAO) Protein

  • EUR 690.00
  • EUR 286.00
  • EUR 2124.00
  • EUR 815.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Mouse Diamine Oxidase (DAO) Protein

  • EUR 690.00
  • EUR 286.00
  • EUR 2124.00
  • EUR 815.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Dao ORF Vector (Mouse) (pORF)

ORF042609 1.0 ug DNA
EUR 506

ELISA kit for Human DAO (Diamine Oxidase)

ELK4306 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to D-Amino Acid Oxidase (DAO). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to D-Amino
  • Show more
Description: A sandwich ELISA kit for detection of Diamine Oxidase from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Pig DAO (Diamine Oxidase)

ELK5633 1 plate of 96 wells
EUR 526
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Diamine Oxidase (DAO). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Diamine Oxid
  • Show more
Description: A sandwich ELISA kit for detection of Diamine Oxidase from Pig in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human DAO (Diamine Oxidase)

ELK1773 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Diamine Oxidase (DAO). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Diamine Oxid
  • Show more
Description: A sandwich ELISA kit for detection of Diamine Oxidase from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Rat DAO (Diamine Oxidase)

ELK2230 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Diamine Oxidase (DAO). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Diamine Oxid
  • Show more
Description: A sandwich ELISA kit for detection of Diamine Oxidase from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Rat DAO (Diamine Oxidase)

E-EL-R0331 1 plate of 96 wells
EUR 534
  • Gentaur's DAO ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Rat DAO. Standards or samples are added to the micro ELISA plate wells and combined with the sp
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Rat DAO (Diamine Oxidase) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human DAO (Diamine Oxidase)

E-EL-H1241 1 plate of 96 wells
EUR 534
  • Gentaur's DAO ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human DAO. Standards or samples are added to the micro ELISA plate wells and combined with the
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human DAO (Diamine Oxidase) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Pig Diamine oxidase (DAO)

KTE80174-48T 48T
EUR 354
  • On the basis of its primary structure, the amiloride-binding protein (EC is 713 amino acids long, with a 19-amino acid signal peptide. Expressed in cultured cells, the mRNA yields a glycoprotein that binds amiloride and amiloride analogs wit
  • Show more
Description: Quantitative sandwich ELISA for measuring Pig Diamine oxidase (DAO) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Pig Diamine oxidase (DAO)

KTE80174-5platesof96wells 5 plates of 96 wells
EUR 2252
  • On the basis of its primary structure, the amiloride-binding protein (EC is 713 amino acids long, with a 19-amino acid signal peptide. Expressed in cultured cells, the mRNA yields a glycoprotein that binds amiloride and amiloride analogs wit
  • Show more
Description: Quantitative sandwich ELISA for measuring Pig Diamine oxidase (DAO) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Pig Diamine oxidase (DAO)

KTE80174-96T 96T
EUR 572
  • On the basis of its primary structure, the amiloride-binding protein (EC is 713 amino acids long, with a 19-amino acid signal peptide. Expressed in cultured cells, the mRNA yields a glycoprotein that binds amiloride and amiloride analogs wit
  • Show more
Description: Quantitative sandwich ELISA for measuring Pig Diamine oxidase (DAO) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Diamine oxidase (DAO)

KTE100901-48T 48T
EUR 354
  • On the basis of its primary structure, the amiloride-binding protein (EC is 713 amino acids long, with a 19-amino acid signal peptide. Expressed in cultured cells, the mRNA yields a glycoprotein that binds amiloride and amiloride analogs wit
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Diamine oxidase (DAO) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Diamine oxidase (DAO)

KTE100901-5platesof96wells 5 plates of 96 wells
EUR 2252
  • On the basis of its primary structure, the amiloride-binding protein (EC is 713 amino acids long, with a 19-amino acid signal peptide. Expressed in cultured cells, the mRNA yields a glycoprotein that binds amiloride and amiloride analogs wit
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Diamine oxidase (DAO) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Diamine oxidase (DAO)

KTE100901-96T 96T
EUR 572
  • On the basis of its primary structure, the amiloride-binding protein (EC is 713 amino acids long, with a 19-amino acid signal peptide. Expressed in cultured cells, the mRNA yields a glycoprotein that binds amiloride and amiloride analogs wit
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Diamine oxidase (DAO) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

DAO Chemi-Luminescent ELISA Kit (Human) (OKCD03409)

OKCD03409 96 Wells
EUR 988
Description: Description of target: Regulates the level of the neuromodulator D-serine in the brain. Has high activity towards D-DOPA and contributes to dopamine synthesis. Could act as a detoxifying agent which removes D-amino acids accumulated during aging. Acts on a variety of D-amino acids with a preference for those having small hydrophobic side chains followed by those bearing polar, aromatic, and basic groups. Does not act on acidic amino acids.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.156 ng/mL

DAO ELISA Kit (Human) : 96 Wells (OKEH02323)

OKEH02323 96 Wells
EUR 740
Description: Description of target: This gene encodes the peroxisomal enzyme D-amino acid oxidase. The enzyme is a flavoprotein which uses flavin adenine dinucleotide (FAD) as its prosthetic group. Its substrates include a wide variety of D-amino acids, but it is inactive on the naturally occurring L-amino acids. Its biological function is not known; it may act as a detoxifying agent which removes D-amino acids that accumulate during aging. In mice, it degrades D-serine, a co-agonist of the NMDA receptor. This gene may play a role in the pathophysiology of schizophrenia.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 38 pg/mL

Column Packing Kit

PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

PCR Mycoplasma Detection Kit

M034-Kit Kit
EUR 266

DAO Conjugated Antibody

C32763 100ul
EUR 397

DAO cloning plasmid

CSB-CL006494HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1044
  • Sequence: atgcgtgtggtggtgattggagcaggagtcatcgggctgtccaccgccctctgcatccatgagcgctaccactcagtcctgcagccactggacataaaggtctacgcggaccgcttcaccccactcaccaccaccgacgtggctgccggcctctggcagccctacctttctgacc
  • Show more
Description: A cloning plasmid for the DAO gene.

anti- DAO antibody

FNab02235 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • IF: 1:50 - 1:200
  • Immunogen: D-amino-acid oxidase
  • Uniprot ID: P14920
  • Gene ID: 1610
  • Research Area: Metabolism
Description: Antibody raised against DAO

DAO Rabbit pAb

A5309-100ul 100 ul
EUR 308

DAO Rabbit pAb

A5309-200ul 200 ul
EUR 459

DAO Rabbit pAb

A5309-20ul 20 ul
EUR 183

DAO Rabbit pAb

A5309-50ul 50 ul
EUR 223

DAO Polyclonal Antibody

A50181 100 µg
EUR 570.55
Description: Ask the seller for details

DAO Blocking Peptide

DF7266-BP 1mg
EUR 195

Anti-DAO antibody

PAab02235 100 ug
EUR 355

Anti-DAO antibody

STJ27262 100 µl
EUR 277
Description: This gene encodes the peroxisomal enzyme D-amino acid oxidase. The enzyme is a flavoprotein which uses flavin adenine dinucleotide (FAD) as its prosthetic group. Its substrates include a wide variety of D-amino acids, but it is inactive on the naturally occurring L-amino acids. Its biological function is not known; it may act as a detoxifying agent which removes D-amino acids that accumulate during aging. In mice, it degrades D-serine, a co-agonist of the NMDA receptor. This gene may play a role in the pathophysiology of schizophrenia.

Dao ELISA Kit| Rat D-amino-acid oxidase ELISA Kit

EF018550 96 Tests
EUR 689

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit

CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9

Human DAO/ D-amino-acid oxidase ELISA Kit

E0656Hu 1 Kit
EUR 605

Human DAO(D-amino-acid oxidase) ELISA Kit

EH1546 96T
EUR 524.1
  • Detection range: 0.781-50 ng/ml
  • Uniprot ID: P14920
  • Alias: DAO(D-amino-acid oxidase)/DAAO/DAMOX
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.469 ng/ml

Rabbit D- amino- acid oxidase, DAO ELISA KIT

ELI-23339Ra 96 Tests
EUR 928

Human D- amino- acid oxidase, DAO ELISA KIT

ELI-35545h 96 Tests
EUR 824

Porcine D- amino- acid oxidase, DAO ELISA KIT

ELI-46591p 96 Tests
EUR 928

Human D-Amino Acid Oxidase (DAO) ELISA Kit

EUR 517
  • Should the Human D-Amino Acid Oxidase (DAO) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human D-Amino Acid Oxidase (DAO) in samples from tissue homogenates or other biological fluids.

Human D-Amino Acid Oxidase (DAO) ELISA Kit

EUR 673
  • Should the Human D-Amino Acid Oxidase (DAO) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human D-Amino Acid Oxidase (DAO) in samples from tissue homogenates or other biological fluids.

Human D-Amino Acid Oxidase ELISA Kit (DAO)

RK01243 96 Tests
EUR 521

Human D-Amino Acid Oxidase (DAO) ELISA Kit

RDR-DAMOX-Hu-48Tests 48 Tests
EUR 544

Human D-Amino Acid Oxidase (DAO) ELISA Kit

RDR-DAMOX-Hu-96Tests 96 Tests
EUR 756

Human D-Amino Acid Oxidase (DAO) ELISA Kit

RD-DAMOX-Hu-48Tests 48 Tests
EUR 521

Human D-Amino Acid Oxidase (DAO) ELISA Kit

RD-DAMOX-Hu-96Tests 96 Tests
EUR 723

Human D-Amino Acid Oxidase (DAO) ELISA Kit

SEJ298Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human D-Amino Acid Oxidase (DAO) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human D-Amino Acid Oxidase (DAO) in serum, plasma, tissue homogenates and other biological fluids.

Human D-Amino Acid Oxidase (DAO) ELISA Kit

SEJ298Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human D-Amino Acid Oxidase (DAO) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human D-Amino Acid Oxidase (DAO) in serum, plasma, tissue homogenates and other biological fluids.

Human D-Amino Acid Oxidase (DAO) ELISA Kit

SEJ298Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human D-Amino Acid Oxidase (DAO) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human D-Amino Acid Oxidase (DAO) in serum, plasma, tissue homogenates and other biological fluids.

These results indicate that this ELISA is a promising aid in the early diagnosis of DENV-1-4 and supervision in areas of endemicity in addition to offering a comfortable monitoring for future vaccine interventions.